Recombinant Human IGF2 Protein, GST-tagged

• Cat.No.: IGF2-01H
• Product Overview: Recombinant Human IGF2 Protein with GST tag was expressed in E. coli.

Specification

• Species: Human
• Source: E.coli
• Tag: GST
• Description: This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
• AA Sequence: CTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTGGGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGTGAGCCGTCGCAGCCGTGGCATCGTTGAGGAGTGCTGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCTACCCCCGCCAAGTCCGAG
• Purity: > 85 %

Gene Information

• Gene Name: IGF2 insulin like growth factor 2 [ Homo sapiens (human) ]
• Official Symbol: IGF2
• Synonyms: IGF2; insulin like growth factor 2; GRDF; SRS3; IGF-II; PP9974; C11orf43; insulin-like growth factor II; T3M-11-derived growth factor; insulin-like growth factor 2 (somatomedin A); insulin-like growth factor type 2; preptin
• Gene ID: 3481
• mRNA Refseq: NM_000612
• Protein Refseq: NP_000603
• MIM: 147470
• UniProt ID: P01344