Recombinant Mononucleosomes, 199x601 DNA, Biotinylated
Cat.No. : | NUC-055 |
Product Overview : | Mononucleosomes assembled from recombinant histones expressed in E. coli. |
- Specification
- Gene Information
- Related Products
- Download
Source : | E.coli |
Tag : | Non |
Description : | Mononucleosomes assembled from recombinant histones expressed in E. coli (two each of histones H2A, H2B, H3 and H4; accession numbers: H2A-P06897; H2B-P02281; H3-Q92133; H4-P62799) wrapped by 199 base pairs of DNA containing the 601 positioning sequence DNA. The the 199 bp DNA sequence contains a 147 base-pair 601 nucleosome positioning sequence. The 601 sequence is flanked by a 26 bp sequence as shown in application notes and contains a 5' biotin-TEG group. |
Form : | Mononucleosomes, Recombinant, 199x601 DNA (50 µg DNA + protein, 24.3 µg protein weight) in 10 mM Tris pH 7.5, 25 mM NaCl, 1 mM EDTA, 2 mM EDTA, 20% glycerol. |
Molecular Mass : | 231,880.55 Da |
Applications : | 5'-Biotin-TEG'-GGACCCTATACGCGGCCGCCGAATTCCTGGAGAATCCCGGTCTGCAGGCCGCTCAATTGGTCGTAGACAGCTCTACGTGGCGAATTTGCGTGCATGCGCCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGGATCCGCCGGTCGCGAACAGCGACC-3' 3'-CCTGGGATATGCGCCGGCGGCTTAAGGACCTCTTAGGGCCAGACGTCCGGCGAGTTAACCAGCATCTGTCGAGATGCACCGCTTAAACGCACGTACGCGGACAGGGGGCGCAAAATTGGCGGTTCCCCTAATGAGGGATCAGAGGTCCGTGCACAGTCTATATATGTAGGACACCTAGGCGGCAGCGCTTGTCGCTGG-5' |
Storage : | Stable for six months at -80°C from date of receipt. For best results, aliquot and avoid multiple freeze/thaws. |
Not For Human Consumption!
Inquiry
- Reviews
- Q&As
Ask a Question for All NUC Products
Required fields are marked with *
My Review for All NUC Products
Required fields are marked with *
0
Inquiry Basket