Creative BioMart to Present at BPS 2025 Annual Meeting | February 15-19, 2025

Recombinant E. coli LexA

Cat.No. : lexA-131E
Product Overview : The product is over-produced as a recombinant protein, and highly purified by several steps of chromatography. A single band is observed by SDS-PAGE at 23 kD.
  • Specification
  • Gene Information
  • Related Products
  • Download
Description : E. coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence(TACTGTATATATATACAGTA). LexA"s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced.
Species : E. coli
Form : 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol
Purity : Over 90% by SDS-PAGE (CBB staining)
Applications : 1) Studies on the mechanism of E. coli SOS response.2) Used as an antigen for positive control in Western blotting to confirm that the Bait construct is expressed stably in the nucleus as protein of the expected size in the yeast two-hybrid method using the lexA gene.
Storage : Shipped at 4℃ or -20℃, and store at -80℃ for long period.
Concentration : 0.8 mg/ml as measured by BCA method
Tag : Non

Not For Human Consumption!

Inquiry

  • Reviews
  • Q&As

Customer Reviews (0)

Write a review

Q&As (0)

Ask a question

Ask a Question for All lexA Products

Required fields are marked with *

My Review for All lexA Products

Required fields are marked with *

0

Inquiry Basket

cartIcon
logo

FOLLOW US

Terms and Conditions        Privacy Policy

Copyright © 2025 Creative BioMart. All Rights Reserved.

Contact Us

  • /
  • Service lnquiry:

Stay Updated on the Latest Bioscience Trends