Recombinant Mononucleosomes, 199x601 DNA
Cat.No. : | NUC-056 |
Product Overview : | Mononucleosomes assembled from recombinant histones expressed in E. coli. |
- Specification
- Gene Information
- Related Products
- Download
Source : | E.coli |
Tag : | Non |
Description : | Mononucleosomes assembled from recombinant histones expressed in E. coli (two each of histones H2A, H2B, H3 and H4; accession numbers: H2A-P06897; H2B-P02281; H3-Q92133; H4-P62799) wrapped by 199 base pairs of DNA containing the 601 positioning sequence DNA. The the 199 bp DNA sequence contains a 147 base-pair 601 nucleosome positioning sequence. The 601 sequence is flanked by a 26 bp sequence as shown in application notes. |
Form : | Mononucleosomes, Recombinant, 199x601 DNA (50 µg DNA + protein, 24.3 µg protein weight) in 10 mM Tris pH 7.5, 25 mM NaCl, 1 mM EDTA, 2 mM EDTA, 20% glycerol. |
Molecular Mass : | 231,289.05 Da |
Applications : | 5'-GGACCCTATACGCGGCCGCCGAATTCCTGGAGAATCCCGGTCTGCAGGCCGCTCAATTGGTCGTAGACAGCTCTACGTGGCGAATTTGCGTGCATGCGCCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGGATCCGCCGGTCGCGAACAGCGACC-3' 3'-CCTGGGATATGCGCCGGCGGCTTAAGGACCTCTTAGGGCCAGACGTCCGGCGAGTTAACCAGCATCTGTCGAGATGCACCGCTTAAACGCACGTACGCGGACAGGGGGCGCAAAATTGGCGGTTCCCCTAATGAGGGATCAGAGGTCCGTGCACAGTCTATATATGTAGGACACCTAGGCGGCAGCGCTTGTCGCTGG-5' |
Storage : | Stable for six months at -80°C from date of receipt. For best results, aliquot and avoid multiple freeze/thaws. |
◆ Recombinant Proteins | ||
NARFL-3563R | Recombinant Rat NARFL Protein, His (Fc)-Avi-tagged | +Inquiry |
RPF1-3782R | Recombinant Rhesus Macaque RPF1 Protein, His (Fc)-Avi-tagged | +Inquiry |
Mtnr1a-8165M | Recombinant Mouse Mtnr1a protein, His-tagged | +Inquiry |
CD1A-720R | Recombinant Rhesus monkey CD1A Protein, His-tagged | +Inquiry |
YCCF-3152B | Recombinant Bacillus subtilis YCCF protein, His-tagged | +Inquiry |
◆ Native Proteins | ||
Collagen Type I-01B | Native Bovine Collagen Type I (Atelocollagen) Protein | +Inquiry |
C3b-09R | Native Rat C3b Protein | +Inquiry |
TIMP1-30840TH | Native Human TIMP1 | +Inquiry |
RSV-09 | Native Respiratory Syncytial Virus (RSV) Antigen | +Inquiry |
Thrombin-29B | Active Native Bovine alpha-Thrombin-FPRck | +Inquiry |
◆ Cell & Tissue Lysates | ||
H2AFZ-5655HCL | Recombinant Human H2AFZ 293 Cell Lysate | +Inquiry |
GDAP1-5974HCL | Recombinant Human GDAP1 293 Cell Lysate | +Inquiry |
SW1353-179H | SW1353 Whole Cell Lysate | +Inquiry |
SNX5-1587HCL | Recombinant Human SNX5 293 Cell Lysate | +Inquiry |
ALKBH8-18HCL | Recombinant Human ALKBH8 lysate | +Inquiry |
Not For Human Consumption!
Inquiry
- Reviews
- Q&As
Ask a Question for All NUC Products
Required fields are marked with *
My Review for All NUC Products
Required fields are marked with *
0
Inquiry Basket